Everything below concerns WADA Prohibited List. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2025-07-28. Numbers and descriptions here follow the published literature rather than marketing material.
Cardarine is prohibited in competitive sport under the World Anti-Doping Agency code, where it is classified as a metabolic modulator. It is not approved as a prescription medicine in the United States, European Union, or other major markets. Regulatory action has focused on its presence in sports and in products marketed as research chemicals. Because it has no accepted medical indication, supply is often unregulated. This status creates legal and safety uncertainties for anyone who encounters the substance.
Anti-doping laboratories detect GW501516 and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is the most common matrix, though blood and dried blood spots may also be used in some programs. Detection depends on factors such as dose, timing, metabolism, and the sensitivity of the assay. Published methods describe limits of detection in the low nanogram per milliliter range for related compounds. Exact detection windows are not fixed for all situations and remain an area of ongoing study.
Products sold as cardarine have been found to contain incorrect compounds, variable amounts, or no active ingredient at all. Independent testing is required to verify identity and purity. Common analytical approaches include high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance for structural confirmation. These methods can distinguish GW501516 from related PPAR agonists and from unrelated steroids. For regulators and researchers, such verification is central to interpreting both biological results and adverse event reports.
Activation of PPARδ changes transcription of genes involved in fatty acid transport, mitochondrial function, and skeletal muscle fuel preference. In rodent studies, pharmacological PPARδ activation was associated with increased endurance and altered body composition. These findings generated interest in performance enhancement, but species differences and study designs limit direct extrapolation to humans. Small human trials were conducted in the 2000s and later discontinued. The extent to which cardarine produces similar metabolic or performance effects in people remains an open question.
The compound is typically described as a laboratory compound rather than a therapeutic product. Published reports have explored its role in lipid disorders, insulin sensitivity, and exercise metabolism, yet no major drug regulator has approved it for medical use. Commercial samples sold under the cardarine name may vary in purity and identity. Analytical confirmation is therefore necessary when the material is discussed in scientific or regulatory contexts. Its classification as a prohibited substance in sport further shapes how it is studied and reported.
Cardarine is a common name for GW501516, a synthetic compound studied for its effects on lipid and glucose metabolism. It functions as an agonist at peroxisome proliferator-activated receptor delta, or PPARδ, a nuclear receptor that influences gene expression. The molecule is not a steroid, nor is it a selective androgen receptor modulator. It is also known in research and sports literature as GW-501516 and endurobol. Early laboratory work examined its metabolic activity in cell cultures and animal models.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Prohibited in sport | Listed by WADA as a metabolic modulator. |
| Approved medical use | None in major jurisdictions | Not a registered drug. |
| Common test matrix | Urine | Most anti-doping samples use urine. |
| Typical detection method | LC-MS/MS | Detects parent compound and metabolites. |
| Reference standard storage | -20 °C, desiccated | Typical for analytical standards. |
Handling and quality assessment of cardarine reference material follow general laboratory practices for poorly characterized compounds. It typically appears as a white to off-white powder and is sparingly soluble in water but soluble in organic solvents such as dimethyl sulfoxide and ethanol. Storage recommendations usually specify a cool, dry, dark place, with long-term storage at low temperature and desiccation. Purity may be checked by high-performance liquid chromatography with ultraviolet detection, while identity is confirmed by mass spectrometry and nuclear magnetic resonance. No pharmacopeial monograph exists, so reported purity and stability depend on the supplier’s methods.
GW501516 acts as a selective agonist at PPARδ, a nuclear receptor that regulates transcription of genes involved in lipid handling and energy metabolism. Activation of PPARδ in preclinical models increases fatty acid oxidation, mitochondrial biogenesis, and exercise endurance in rodents. These effects have made the compound a subject of metabolic research and also a target for sport anti-doping rules. In humans, however, controlled studies are limited, and whether similar endurance or metabolic changes occur at tolerated exposures remains an open question. The receptor’s broad tissue distribution also means downstream effects may vary by organ and condition.
Detection of GW501516 in biological samples generally relies on liquid chromatography coupled with tandem mass spectrometry. Urine is a common matrix in anti-doping analysis, while blood or plasma may be used in research settings. Sample preparation can involve enzymatic hydrolysis, protein precipitation, or solid-phase extraction before instrumental analysis. Because the compound undergoes metabolism, assays may target the parent molecule, one or more metabolites, or both. Detection windows are not fixed; they depend on factors such as dose, route, individual metabolism, and assay sensitivity. Reference standards are required for accurate identification and quantification.
Because cardarine is not an approved medicine, no pharmacopeial monograph defines its identity, purity, or storage requirements. Laboratories typically rely on in-house methods and reference standards when testing materials labeled as GW501516. Certificates of analysis may report purity and identity for a specific batch, but their scope varies and they do not guarantee safety or legal status. Independent verification can include high-performance liquid chromatography, mass spectrometry, nuclear magnetic resonance, and elemental analysis. The distinction between research chemical labeling and human use is significant because quality standards and oversight differ.
Cardarine can be detected in biological samples and product materials using liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). The method separates compounds by chromatography and identifies them by mass-to-charge transitions, allowing low-level detection in urine or blood. Sample preparation often involves enzymatic hydrolysis, solid-phase extraction, or protein precipitation. Certified reference materials and isotope-labeled internal standards improve quantification. Detection windows depend on metabolism, matrix, and assay sensitivity, so no single universal window applies.
The island is known for using geothermal energy to provide electricity for its inhabitants. In San Carlos, Negros Occidental where energy company San Carlos Solar Energy (SaCaSol) is located, solar energy is being used to power the city and surrounding municipalities. Inland towns and cities of Negros uses hydroelectric power acquired from springs, rivers and waterfalls. Due to the island region's sugarcane-based agriculture, Negros may become the nation's major biofuel producer, with sugarcane being used for ethanol production.
=== Society === Nigeria has been generating most of its revenue from oil industry for the past 30 years. However, since petroleum industry has appeared, many pollution problems have risen in Nigeria. The major problem was caused by oil spills, occurring during usual operations. From 1976 to 1988, 2000 oil spillages happened in Nigeria and more than two million barrels of bonny light oil were released to the community during this period. Additionally, break of oil pipelines, erosion of flow and trunk lines, and hose failure are the causes of oil spills. Consequently, both the aquatic milieu and environment had detrimental impacts by them. These ecosystems are key element in agricultural productivity and main source for Nigerians, inhabiting in the oil-producing areas, to live. Therefore, some activists in Nigeria have spoiled pipelines, and key infrastructures which are related to crude oil and export flows are usually targeted. As a result, the issue related to oil effusion in Nigeria has been exacerbated. In Nigeria, microbial seeding is being considered instead of mechanical ways by the main oil companies for the purpose of cleaning up oil spills.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
PDK phosphorylates three specific serine residues on E1 with different affinities. Phosphorylation of any one of them (using ATP) renders E1 (and in consequence the entire complex) inactive. Dephosphorylation of E1 by PDP reinstates complex activity. Products of the reaction act as allosteric inhibitors of the PDC, because they activate PDK. Substrates in turn inhibit PDK, reactivating PDC. During starvation, PDK increases in amount in most tissues, including skeletal muscle, via increased gene transcription. Under the same conditions, the amount of PDP decreases. The resulting inhibition of PDC prevents muscle and other tissues from catabolizing glucose and gluconeogenesis precursors. Metabolism shifts toward fat utilization, while muscle protein breakdown to supply gluconeogenesis precursors is minimized, and available glucose is spared for use by the brain. Calcium ions have a role in regulation of PDC in muscle tissue, because it activates PDP, stimulating glycolysis on its release into the cytosol - during muscle contraction. Some products of these transcriptions release H2 into the muscles. This can cause calcium ions to decay over time.
Sources: en.wikipedia.org
=== Downworlders === Hypatia Vex — a warlock who owns the Hell Ruelle. Malcolm Fade — High Warlock of London, succeeding Ragnor Fell. Magnus Bane — a powerful warlock, and old friend of Will Herondale's and Tessa Gray's.
Betadine products and medical variants by Avrio Health (part of Purdue Pharma) Ingredients: Povidon-iodine etc. As of June 2021, not recommended by manufacturer to "kill" coronaviruses. Bleach products: Clorox Cyosan Zonrox Bleach Henkel products: biff Hygiene Total Ingredients: Benzalkonium chloride and formic acid Tested against SARS-CoV-2 according to producer statement on website. Bref Power Bakterien & Schimmel Purex Heitmann Hygiene & Care products: Universal Hygiene Laundry Rinse 1.5 Ingredients: Didecyldimethylammonium chloride Hygiene Spray Ingredients: Ethanol, 2-propanol According to manufacturer is effective against coronaviruses, including SARS-CoV-2 Listerine Ingredients: Alcohol, sodium fluoride, essential oils (specifically in case of management of inflammatory periodontal diseases) Unknown or limited virucidal activity Lysol Ingredient: Benzalkonium chloride Some of the products having been tested against SARS-CoV-2. Sterillium Ingredients: 1-Propanol, 2-propanol and mecetronium ethylsulfate By former Bode Chemie, now Hartmann AG, one of Germany's major health-care brands available in 50 countries, and according to website "the world's most scientifically researched hand disinfectant with approximately 60 scientific publications in trade journals in 2015."
Later on, his statements about doping in the Bundesliga were supported by Per Roentved, Hans Werner Moors, Dieter Schatzscheider, Hans-Josef Kapellmann, Peter Neururer, Benno Möhlmann, Uwe Nester, Peter Geyer (who talked about procedure, quantity and side effects), Jürgen Röber, Jürgen Stumm and Peter Harms (both medics). At Olympique Marseille, doping took place according to Marcel Desailly, Jean-Jacques Eydelie, Chris Waddle, and Tony Cascarino. They told about stimulants taken prior to their big games, which made them more energetic and keen. According to Eydelie, "all [of them] took a series of injections" in the 1993 Champions League final, except Rudi Völler. All this was no surprise for Arsene Wenger, who said everyone in France assumed something like that going on. Additionally, Desailly and Cascarino claimed that Bernard Tapie, the president himself, distributed pills and injections. Author Mondenard also mentioned "injections for everyone". Tapie only admitted that some players took Captagon. Although Juventus won the 1996 Champions League final, the victory was overshowed by of accusations of doping. The Juventus team has been accused of using erythropoietin (EPO) and the matter went to trial in 2004.
A nonstop mutation, also called a stop-loss variant, is a point mutation that occurs within a stop codon. Nonstop mutations cause the continued translation of an mRNA strand into what should be an untranslated region. Most polypeptides resulting from a gene with a nonstop mutation lose their function due to their extreme length and the impact on normal folding. Nonstop mutations differ from nonsense mutations in that they do not create a stop codon but, instead, delete one. Nonstop mutations also differ from missense mutations, which are point mutations where a single nucleotide is changed to cause replacement by a different amino acid. Nonstop mutations have been linked with many inherited diseases including endocrine disorders, eye disease, and neurodevelopmental disorders.
There was therefore an unwritten agreement that this war would be a "white man's war." At the outset, British officials instructed all white magistrates in the Natal Colony to appeal to Zulu amakhosi (chiefs) to remain neutral, and President Kruger sent emissaries asking them to stay out of it. However, in some cases there were old scores to be settled, and some Indigenous Africans, such as the Swazis, were eager to enter the war with the specific aim of reclaiming land won by the Boers. As the war went on there was greater involvement of Indigenous Africans, and in particular large numbers became embroiled in the conflict on the British side, either voluntarily or involuntarily. By the end of the war, many Indigenous Africans had been armed and had shown conspicuous gallantry in roles such as scouts, messengers, watchmen in blockhouses, and auxiliaries.
Sources: en.wikipedia.org
The following is a partial list of the "D" codes for Medical Subject Headings (MeSH), as defined by the United States National Library of Medicine (NLM). This list continues the information at List of MeSH codes (D10). Codes following these are found at List of MeSH codes (D12.644). For other MeSH codes, see List of MeSH codes. The source for this content is the set of 2006 MeSH Trees from the NLM.
=== Elimination === Small amounts of metabolites (alpha-methyldopa and alpha-methyldopamine) were found after the administration of both single-doses and maintenance-doses of AMPT. Small amounts of methyltyramine and alpha-methylnoradrenaline were found in patients undergoing AMPT therapy. Urine analysis also recovered 45 to 88 percent of unchanged AMPT after drug ingestion. Of the total AMPT excreted, 50 to 60 percent appeared in urine within the first 8 hours and 80 to 90 percent appeared within 24 hours of oral administration.
The elderly, disabled, and people with impaired immune systems, such as those with HIV/AIDS, cancer, or those on immunosuppressive medications, are susceptible to crusted scabies (also called Norwegian scabies). On those with weaker immune systems, the host becomes a more fertile breeding ground for the mites, which spread over the host's body, except the face. The mites in crusted scabies are not more virulent than in noncrusted scabies but are much more numerous, sometimes up to two million. People with crusted scabies exhibit scaly rashes, slight itching, and thick crusts of skin that contain large numbers of scabies mites. For this reason, persons with crusted scabies are more contagious to others than those with typical scabies. Such areas make eradication of mites particularly difficult, as the crusts protect the mites from topical miticides/scabicides, necessitating prolonged treatment of these areas.
== Production == Argon is extracted industrially by the fractional distillation of liquid air in a cryogenic air separation unit; a process that separates liquid nitrogen, which boils at 77.3 K, from argon, which boils at 87.3 K, and liquid oxygen, which boils at 90.2 K. About 700,000 tonnes of argon are produced worldwide every year.
== Mechanism of action == Orforglipron is a small-molecule, partial GLP-1 receptor agonist affecting the activity of cyclic adenosine monophosphate (cAMP); its effects are similar to the actions of glucagon-like peptide-1 (GLP-1) for reducing food intake and lowering blood glucose levels.
Sources: en.wikipedia.org
Legal status varies by country, but cardarine is not approved as a medicine in major jurisdictions. It is often sold as a research chemical, a category that may not be lawful for human use. Buyers should check local laws and product labels carefully.
Anti-doping laboratories use LC-MS/MS to detect GW501516 and its metabolites, usually in urine. The method can identify the parent compound at low concentrations. Detection windows vary with dose and individual factors.
No, cardarine has no approved medical uses in major jurisdictions. Early research explored metabolic conditions, but those programs were discontinued. It is not a registered treatment for any disease.
Cardarine is a common name for GW501516, a synthetic PPARδ agonist. It is not a steroid or a selective androgen receptor modulator. It was developed and studied as a research compound for metabolic pathways.